general recommendations for the treatment of internal contamination tiara ec
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
Ngày tải lên :
12/05/2014, 17:14
... and Technologies, Advance Institute of Science and Technology, Department of Organic and Petrochemical Technology, Laboratory of the Petrochemical Refinering and Catalytic Materials, School of ... Part of the fuel is employed for scavenging of the exhaust, which does not allow to define a precise definition of the A/F 1.2 Treatments of air pollution With the development of science and technology, ... catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine 1.4 Mechanism of the reactions 1.4.1 Mechanism of hydrocarbon...
- 117
- 376
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
Ngày tải lên :
26/10/2012, 09:32
... relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar facet injection patients received permanent relief Of the 114 ... following dorsal root rhizotomy We speculate that the direct visualization of the joint allows better de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone ... restraints of the surgery RESULTS A total of 174 people (77 women, 97 men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet...
- 4
- 599
- 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
Ngày tải lên :
26/10/2012, 09:57
... with endoscopic laminoforaminoplasty via a small incision, of less than one inch Materials and Methods Twelve patients were treated with endoscopic laminoforaminoplasty (ELFP) of the thoracic spine ... remove bone and smooth the bony edges of the opening A holmium laser and electrocautery was used for hemocoaugulation and to remove soft issues Once the region was decompressed, the surgery was completed ... foraminal and not central since 66% of patients had foraminal stenosis The lower thoracic spine appears to be most commonly affected The correct surgical management of these patients is based largely...
- 3
- 506
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
Ngày tải lên :
05/09/2013, 09:38
... detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection of Nitrospira species ... activities of nitrite oxidizing bacteria - 31 - Journal of Water and Environment Technology, Vol.5, No.1, 2007 Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter ... Behavior of Nitrobacter species The analysis of nitrite oxidizing bacteria was performed with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with...
- 8
- 572
- 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
Ngày tải lên :
05/09/2013, 09:38
... values of the constant characteristics for the two models are listed in Table CONCLUSIONS In this study, technical feasibility of this process was demonstrated The effects of recycle ratio, HRT of ... at 40% (with a recycling sludge flowrate of L/h) and d, respectively, the HRT of the regeneration tank was decreased stepwise from h to h for the three reactors, while the HRT of the adsorption ... individual effect of the solids retention time (SRT), hydraulic retention time (HRT) of the regeneration tank, recycle ratio (R), and HRT of the adsorption tank In Series I, the recycle ratio...
- 8
- 686
- 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx
Ngày tải lên :
14/02/2014, 22:20
... University of Exeter Professor Andrew Stevens (Chair) Professor of Public Health, University of Birmingham B NICE Project Team Each appraisal of a technology is assigned to a Health Technology ... NICE technology appraisal guidance 118 27 Professor John Cairns Professor of Health Economics, Department of Public Health and Policy, London School of Hygiene and Tropical Medicine Professor ... Trust Professor Philip Home Professor of Diabetes Medicine, University of Newcastle upon Tyne Dr Peter Jackson Clinical Pharmacologist, University of Sheffield Professor Peter Jones Professor of Statistics...
- 34
- 853
- 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx
Ngày tải lên :
05/03/2014, 10:20
... treatment of melanoma, resistant CML, and recurrent, metastatic, or inoperable carcinoma of the ovary Mechanism of Action The precise mechanism by which hydroxyurea produces its varied effects is ... methodological quality of the MSH was excellent (Jadad score of 5, out of a maximum of 5) and that of the Belgium study was moderate (Jadad score of 3), because the method of masking was not described ... precursors, resulting in the recruitment of early erythroid precursors with an increased capacity to produce Hb F One recent study supports a nitric oxide-derived mechanism for the induction of...
- 298
- 1.1K
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... result of an aberrant shift in activity of tau kinases and phosphatases [3] Thus, although targeting plaques and NFTs may ameliorate some of the consequences of AD and no doubt lessen the burden of ... bio-availability causes decreased activity of critical enzymes because activity of the enzymes is dependent on optimal metal loading Cu deficiency is central to the recessive Menkes and Wilson ... concentrations of glutamate present and quenches the response of the NMDA receptor [36] Like Cu and Fe, considerable data indicates a loss of Zn homeostasis in AD Abnormally high concentrations of Zn...
- 9
- 634
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
Ngày tải lên :
22/03/2014, 15:21
... target receptor is changed This could potentially influence cytotoxicity in a variety of ways, from changing the number of receptor sites per cell to altering the rate of internalization of the receptor ... death A general description of the pathway is deceptively simple, and many of the specifics are not clear Figure attempts to presents a comprehensive description of PE intoxication, the details of ... or receptor ligands [19,20] gradually gave way to the more efficient production of recombinant molecules in which domain Ia of PE was replaced by a ligand [21] or the variable fragment (Fv) of...
- 18
- 528
- 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
Ngày tải lên :
28/03/2014, 14:20
... different types of PFMT? What other reported factors could affect outcome of physical therapy? What is the optimal period of treatment and number of treatments? What is the effectiveness of physical ... months 21 (38) 38.5 (1) 84.5 (1) NR (1) = subjective rate of cure Types of outcomes A summary of the outcome measures used in terms of the ICS recommendations is presented in Table 12 Outcomes ... was 44% & 56% [34] and 58% & 40% [47] in terms of the number of subjects cured by objective and subjective measures respectively at months Rates of cure/improvement were higher: 48% [34] and 93%...
- 28
- 738
- 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx
Ngày tải lên :
28/03/2014, 23:20
... Panel formulated recommendations based on review of all material and the Panel members' expert opinions and experience which includes the treatment of several thousands of patients Recommendations ... through a consensus process and may not reflect a unanimous decision by the Panel members Levels of evidence were assigned based on the recommendations of the U.S Preventive Services Task Force ... prior history of transurethral resection of the prostate (TURP) is a relative contraindication for cryosurgery, especially if there is a large transurethral resection (TUR) defect present These...
- 51
- 417
- 0
RECOMMENDATIONS FOR THE SECURITY OF INTERNET PAYMENTS ppt
Ngày tải lên :
29/03/2014, 20:20
... THE SECURITY OF RETAIL PAYMENTS 24 ECB Recommendations for the security of internet payments April 2012 GENERAL PART This report presents a set of recommendations to improve the security of internet ... the forthcoming review of the Payment Services ECB Recommendations for the security of internet payments April 2012 RECOMMENDATIONS GENERAL CONTROL AND SECURITY ENVIRONMENT Recommendation 1: Governance ... and of the Council of 13 November 2007 on payment services in the internal market amending Directives 97/7 /EC, 2002/65 /EC, 2005/60 /EC and 2006/48 /EC and repealing Directive 97/5 /EC, OJ L 319, 5.12.2007,...
- 26
- 351
- 0
Model Procedures for the Management of Land Contamination pot
Ngày tải lên :
31/03/2014, 13:20
... next stage of options appraisal • Decision record – the site-specific objectives and the shortlist of remediation options • An explanation of the basis on which the selection of objectives and ... land contamination involves direct observation of the effects or consequences of the existence of a hazard This could take the form of visible pollutants leaching into water, or the observation of ... remediation of land affected by contamination; • As part of managing potential liabilities on an individual site or a portfolio of sites; • During the redevelopment of sites that may be affected by contamination...
- 203
- 347
- 0
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
Ngày tải lên :
18/06/2014, 15:20
... effects, Alemtuzumab may be an effective therapeutic in other solid tumors The identification of an FDAapproved agent with a significant history of clinical use will allow immediate proof -of- principle ... VLC specimens (Figure 2A and 2B) While CD31 mRNA was readily detected, no CD52 mRNA expression was detected in CD45(-)/VE-Cadherin+/CD146+ tumor endothelial cells (TECs) FACS analysis of ficoll ... Alemtuzumab a population of CD45+/VE-Cadherin+ cells was clearly detectable (box) In contrast in the presence of active Alemtuzumab there is as significant reduction of VLC (2) Loss of CD45+/VE-Cadherin+...
- 14
- 728
- 0
báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx
Ngày tải lên :
18/06/2014, 15:20
... formation of new anatomic defects within and between endothelial cells of the BBB following disruption of the overlaying glycocalyx On the basis of our recent findings[73,74], in the context of what ... molecular weight of naked PAMAM dendrimer obtained from Dendritech, Inc ‡molecular weight measured by MALDI-TOF mass spectrometry &molar relaxivity of Gd-DTPA measured to be 4.1 mM-1s-1 ment of brain ... strategy has been the use of lipophilic small molecule drugs for increased permeation of drug fraction across endothelial cells of the BBTB[40,41] The effectiveness of this approach has been...
- 14
- 492
- 0
Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc
Ngày tải lên :
19/06/2014, 08:20
... a different modality of recovery of these subjects with respect to stroke survivors While in stroke subjects recovery is driven by motor errors, in MS cerebellar subjects recovery may be triggered ... with respect to the training protocol, in the sense that they did not receive a detailed explanation of the modalities of generation of force by the robot Moreover, each subject had peculiar patterns ... occurring during the Subject Training phase, we directly compared (planned comparisons) Baseline and Baseline (effect of Robot Training), Baseline and Wash-out (effect of Subject Training) and finally...
- 11
- 596
- 0
báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx
Ngày tải lên :
20/06/2014, 01:20
... intervals until evidence of union was detected Finally, all the patients were recalled to attend a specially set up clinic for the final assessment with respect to the purpose of the study Ethics ... incidence of olecranon fractures showed a higher prevalence among men until the 5th decade of life and among women in older ages Similarly, Rommens et al [9] reported that nearly half of men with olecranon ... hole for the figure -of- eight tension band wire anterior to Table 1: Elbow range of motion (ROM) in affected and unaffected limb Elbow Flexion Supination Pronation Affected Unaffected 136.5 ± 7.9*...
- 6
- 492
- 0
báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf
Ngày tải lên :
20/06/2014, 01:20
... pseudarthrosis was resected completely, whereas resection of the sclerotic bone ends was minimal After correction of angular deformity, a slot was created to receive the fibular graft which was secured by ... the initial trial of VFG, and the other was for the second trial of VFG after failure of bone consolidation in ipsilateral VFG Patients The mean age of the patients at the time of VFG surgery was ... surgeons including some of the authors Operative technique The method of VFG is summarized as follows: Before operation, the vascular anatomy was determined by angiography Dissection of the vascularised...
- 7
- 502
- 0
báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot
Ngày tải lên :
20/06/2014, 04:20
... report of early failure of SSPF for thoracolumbar burst fracture noted three kinds of hardware failure with this fixation: progressive kyphosis secondary to the bending of screws, kyphosis secondary ... the effectiveness of this construct in patients with laminectomy would be helpful to confirm the success of this technique We think this could be the only weak factor in our study and we recommend ... Vassiliou A: The effect of three column of spine on the instantaneous axis of rotation in flexion and extension Spine 1991, 16:S312-318 Gurr KR, McAfee PC, Shih CM: Biomechanical analysis of anterior...
- 6
- 519
- 1
![báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc](https://media.store123doc.com/images/document/2014_06/20/medium_dlb1403212808.jpg)
báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc
Ngày tải lên :
20/06/2014, 04:20
... stable fixation With the technique of indirect reduction for secondary bone healing, the LC-DCP can be inserted over the submuscular plane and it can decrease soft tissue dissection and preserve the ... data concerning the effect of the fracture on leg length and the ability of the femur to deformity remodeling at this level The treatment of displaced supracondylar fractures of the femur depends ... disturbance of distal femoral physis by the use of this implant During the insertion of the LISS tibial plate, we needed to have a good template and plan especially for the insertion of locking...
- 6
- 438
- 0